All genes available for an organism to use -- a very important tool for biologists ليتوافر كل جينات الكائن الحي لإلستخدام بواسطة علماء األحياء Not just sequence of genes, but also positioning of genes and sequences of regulatory regions تسلسل الحمض النووي يعني تحديد مواقع الجينات وتسلسل مواقع التنظيم New recombinant DNA constructs must be sequenced to verify construction or positions of mutations بناء الحمض النووي المؤتلف لتحقيق البناء أو تموضع الطفرات
Nitrogenous Bases القواعد النيتروجينية
Nucleosides النيكليوتيدات Base linked to a 2-deoxy-D-ribose at 1 carbon إرتباط القاعدة النيتروجينة مع السكر عند ذرة الكربون 1 Nucleosides with a phosphate at 5 carbon إرتباط النيكليوسايد مع الفوسفات عند ذرة الكربون- 5
Determining the Sequence of DNA تحديد تسلسل الحمض النووي Methods: الطرق : Chain termination or dideoxy method 1. فك إرتباط السلسلة أو دي-ديوكسي F. Sanger سانقر Shotgun sequence method طريقة التسلسل القسري 2 nd generation sequence methods طرق الجيل الثاني )بايرو التسلسل( Pyrosequencing
(Sanger) Method طريقة سانقر 4 Steps: أربع خطوات Denaturation المسخ Primer attachment and extension of bases لصق البادئات وتوسيع القواعد Termination اإلنتهاء Gel electrophoresis هالم الرحالن الكهربي
for dideoxy sequencing you need: Single stranded DNA template A primer for DNA synthesis DNA polymerase اإلحتياجات : خيط مفرد من الحمض النووي كقالب بادئة لتخليق الحمض النووي إنزيم بولي ميريز الحمض النووي Deoxynucleoside triphosphates and dideoxynucleotide triphosphates ديوكسي نيكايوتايد ثالثي الفوسفتيز ودي-دينيكليوتايد ثالثي الفوسفتيز -
Oligonucleotide primers can be synthesized by phosphoramidite chemistry--usually designed manually and then purchased نيكليوتايد أحادي عادة يتم تصميمها يدويا ومن ثم شراؤها Sequence of the oligo must be complimentary to DNA flanking sequenced region يجب أن يكون تسلسل األحادي مكمال ألجنحة الحمض النووي في منطقة التسلسل Oligos are usually 15-30 nucleotides in length األحاديات تكون دائما 30-15 نيكليوتيدة في طولها
Single stranded DNA isolated from recombinant M13 bacteriophage containing DNA of interest ي عزل الخيط األ حادي للحمض النووي من البكتريا التي تحوي الحمض النووي تحت الدراسة Double-stranded DNA that has been denatured خيط مزدوج من الحمض النووي الممسوخ Non-denatured double stranded DNA (cycle sequencing) خيط مزدوج من الحمض النووي غير الممسوخ
Should be highly processive, and incorporate ddntps efficiently يجب أن يكون عالي المعالجة له القدرة على دمج اإلنزيم بكفاءة عالية Should lack exonuclease activity يفتقد للنشاط خارج النواة Thermostability required for cycle sequencing مستقر حراريا مطلوبة لدورات التسلسل
(Sanger) Method مختصر طريقة سانقر
(Sanger) Method مختصر طريقة سانقر
Run four separate reactions each with different ddntps إجراء أربع تفاعالت مختلفة Run on a gel in four separate lanes إجراء اإلختبار على الهالم Read the gel from the bottom up قراءة الهالم من أسفل الى أعلي
The dideoxy method is good only for 500-750bp reactions تعتبر هذه الطريقة مثالية فقط للتفاعالت من 750-500 زوج قواعد نيتروجينة Expensive Takes a while م كلفة تأخذ الكثير من الوقت The human genome is about 3 billion bp ال يمكن إستخدامها في الجينوم البشري )3 بليون زوج قاعدة نيتروجينة
Began in 1990 Why? Human evolution Nature versus nurture Causes of disease بدأ في العام 1990 األسباب التطور البشري الطبيعة مقابل التغذية مسببات األمراض
Used to sequence whole genomes Steps: يستخدم لتسلسل كل الجينوم الخطوات DNA is broken up randomly into smaller fragments كسر الحمض النووي عشوائيا ألجزاء صغيرة Dideoxy method produces reads تطبيق طريقة سانقر Look for overlap of reads تحديد التداخالت Strand First Shotgun Sequence Second Shotgun Sequence Reconstruction Sequence AGCATGCTGCAGTCATGCT------- -------------------TAGGCTA AGCATG-------------------- ------CTGCAGTCATGCTTAGGCTA AGCATGCTGCAGTCATGCTTAGGCTA
Sequencing by synthesis Advantages: Accurate Parallel processing Easily automated التسلسل بالتخليق المزايا : دقيق معالجة متوازية سهولة في عمله آليا
Eliminates the need for labeled primers and nucleotides ال يحتاج الى بادئات م عرفة ونيكليوتيدات No need for gel electrophoresis ال يحتاج لهالم الرحالن الكهربي
Basic idea: الفكرة األساسية Visible light is generated and is proportional to the number of incorporated nucleotides تسليط إضاءة مرئية تتناسب مع عدد النيكليوتيدات المدرجة 1pmol DNA = 6*10 11 ATP = 6*10 9 photons at 560nm
Smaller sequences تسلسالت صغيرة Nonlinear light response after more than 5-6 identical nucleotides عدم وجود رد فعل للضوء بعد 6-5 نيكليوتيدات متماثلة